@2024 Afarand., IRAN

---

ISSN: 2251-8215    Sarem Journal of Reproductive Medicine 2017;1(2):43-48

Background
Cytomegalovirus (CMV), a member of the herpesviridae family, is a commonly found congenital viral ‎infection in many population groups that occurs in all age groups and at all levels of the community [1, ‎‎2].‎
Previous Studies
Cytomegalovirus infection is usually asymptomatic, but sometimes it occurs in some patients with ‎serious and deadly infection. The cytomegalovirus remains in the latent form after a period of active ‎infection. The virus can be reactivated at an appropriate time, such as pregnancy, and the fetus also ‎receives cytomegalovirus infection through the mother. ‎ ‎… [3-7].From primary infection and recurrent cytomegalovirus infection, the highest rates of ‎congenital infection is related to mothers who have been infected initially. In cases where the first ‎infection occurs in the last trimester of pregnancy, it is more likely that it will be transmitted to the ‎fetus. However, if the primary infection occurs in the first trimester or early in the second trimester, ‎the chances of transmission is lower, and if transmitted, causes more severe damage to the fetus [3, 5, ‎‎8, and 9]. ‎ Anti-cytomegalovirus antibodies cannot completely protect the mother and the fetus against infection, ‎infection return, and infection transmission [9-12]. The presence of IgM is also not valid reason for the ‎presence of primary cytomegalovirus infection, since in the case of an infectious disease, there is also ‎an antibody of IgM class, and an antibody titer is beneficial in these cases [2, 5, 13, and ‎‎14].cytomegalovirus is now a major contributor to congenital malformation, mental retardation, ‎abortion and infections in neonates and infants. Cytomegalovirus infections have numerous economic, ‎social, and psychological losses [15, 7-17]. In Iran, there is no definite figure for the incidence of ‎congenital cytomegalovirus infection and congenital cytomegalovirus diseases have large side effects ‎and costs. In these cases, the definitive diagnosis of cytomegalovirus infection is based on the ‎isolation of the virus. However, in many cases, especially in screening tests, there is no possibility of ‎the cultivation of the virus (due to its expensiveness and time-consuming nature) [3, 18-22].‎
Aim(s)
The aim of this study was to investigate and compare the molecular method in diagnosis of the disease ‎with other conducted methods and the importance of the molecular method for rapid and correct ‎testing.‎
Research type
This research is descriptive-analytic.‎
Research society, place and time
In this study, women who were referred to Javaheri, Bouali, and Amiralmomenin hospitals (affiliated ‎to the Islamic Azad University, Tehran Central Branch) in different weeks of pregnancy and women ‎who had normal delivery were examined in the years 2010-2011. ‎
Sampling method and number
‎60 women who had referred for abortion in different weeks of pregnancy and 60 women with normal ‎delivery were examined. ‎
Used devices&materials
Before the study, consent was taken from all the patients and a questionnaire including age, ‎occupation, history of previous illness, number of pregnancy and previous delivery, abortion time, and ‎number of abortions was designed and the patient`s information revealed from interview was entered ‎into it. ‎ Under the class II hood, amniotic fluid was taken from mothers. The samples were first numbered and ‎the same numbers were written in separate tubes, and then 200 μl of each sample was poured into the ‎corresponding tubes. The samples were stored in a freezer. The samples were concentrated and then ‎the DNA was extracted. ‎ Amniotic fluid samples were prepared for the extraction of the nucleic acid and the ROCHE kit was ‎used according to the kit method to isolate the DNA. The buffer gene code 280 was amplified using the ‎primers PCR and using primers F GTAGCTGGCATTGCGATTGGT and R TCCAACACCCACAGTACCCGT. ‎PCA was performed in 50 μl tube containing 2 μl KCL, 2 μl Tris (pH 8), 5 μl dNTP, 1.5 μl MgCl2, 1UTaq ‎polymerase, 2727 μl water (molecular DDW grade), 20 Pico mole from each primer and 6-10 μl of ‎isolated DNA. ‎ ‎ Initial denaturation at 94 ° C for 90 seconds, 40 cycles of denaturation at 94 ° C for 50 seconds, ‎initially annealed at 64 ° C for 50 seconds, a format at 72 ° C for 50 seconds, and a 72 ° C cyclic cycle ‎for 10 minutes were applied, and the product obtained by agarose gel 1.5% along with ethidium ‎bromide was evaluated and identified.‎ Data were analyzed by chi-square test using SPSS 13 software and the results were compared in two ‎groups of abortion (case group) and normal delivery group. ‎
Findings by Text
The age range of the case and control group was 25-30 and 30-35 respectively. The mean age of women ‎in the case and control group was 28.50±6.68 and 29.00±5.87 years, respectively. In the women of the ‎case group, the results of PCR was positive for 7(18.9%), 5(27.8%), and 4(80.0%) samples who had no ‎history of abortion (zero abortion), one abortion and two abortions respectively. In the control group, ‎the results of PCR was negative. In the control group, 85.0% of the cases had no history of abortion, ‎and 15.0% had one abortion. In addition, in the control group, 5% of the cases had abortion in less than ‎‎20 weeks of pregnancy and 8.3% had preterm delivery or intrauterine death. There was significant ‎relationship between the incidence of CMV and the number of abortions in the mothers of the case ‎group (p<0.05; Table 1).‎
Main comparison to the similar studies
‎… [23-26].A study by Ryan et al. in 2005 it was found that cytomegalovirus infection has contaminated ‎about 50-80% of the adult population. This statistic is based on antibody measurements in the ‎population. In addition, it has been shown that cytomegalovirus is the most commonly transmitted ‎mother to fetus virus before the birth. In the low socio-economic conditions in the third world ‎countries, this virus is the most responsible virus in the herpes family for the embryo and neonatal ‎disorders [4, 9, and 14]. In a study by Boeckh et al. in 2004, cytomegalovirus was the most important ‎congenital infections in humans and the second cause of mental retardation (after Down syndrome). ‎The virus is one of the factors among the infections of Torch syndrome that causes congenital ‎anomalies and disorders. In the United States, the prevalence of primary infections of cytomegalovirus ‎in pregnant women was reported to be about 1-3%. Pregnant women do not show any signs. However, ‎in some cases they are seen as having a mononucleosis-like condition and their fetus is at the risk for ‎congenital cytomegalovirus. Now, cytomegalovirus remains the leading cause of congenital viral ‎infection in the United States [10].‎ In 2003, a study was conducted by Sukhikh, in which serological methods such as IgM and IgG ‎antibody specific kits were used. In this study, PCR was also used to confirm the presence of ‎cytomegalovirus infection in urine specimen, saliva, and amniotic fluid, and the value of the vaccine in ‎preventing infection [8]. ‎ In the study of Griffith et al., the prevalence of cytomegalovirus infection with rubella virus in pregnant ‎women was investigated. In 15% of women with primary cytomegalovirus infection, fetal loss was ‎seen and this rate was 7 times higher than control samples. The transmission of the virus in the first ‎trimester, second trimester and the third trimester was 20%, 0% and 40% respectively [21].‎
Suggestions
It is suggested that more studies be done to evaluate molecular methods and compare the sensitivity ‎and the specificity of it with other methods in the larger population, taking into account geographical ‎condition.‎
Limitations

Conclusions
Considering the importance of quick and correct detection of the disease agent before its ‎complications, the molecular method can help to this end even in cases of low pathogenicity. ‎
Acknowledgments

Conflict of interest

Ethical Permissions

Funding Sources

TABLES and CHARTS

Show attach file