
@2026 Afarand., IRAN
ISSN: 2251-8215 Sarem Journal of Reproductive Medicine 2017;1(2):43-48
ISSN: 2251-8215 Sarem Journal of Reproductive Medicine 2017;1(2):43-48
Evaluation of Cytomegalovirus (CMV) in Abortion compared with embryos vaginal delivery by using PCR
ARTICLE INFO
Article Type
Original ResearchAuthors
Zaker Bostanabad S. (*)Rahimi M.K. (1)
Mahdavi M. (2)
Pourazar Sh. (3)
(*) Biological Sciences Faculty, Parand Branch, Isalmic Azad University, Tehran, Iran
(1) Medicine Faculty, Tehran Medical Branch, Islamic Azad University, Tehran, Iran
(2) Molecular Department, Khatam Hospital, Tehran, Iran
(3) Molecular Department, “Masoud Lab” and “Sarem Women’s Hospital”, Tehran, Iran
Correspondence
Article History
Received: February 20, 2014Accepted: May 19, 2016
ePublished: June 15, 2017
BRIEF TEXT
Cytomegalovirus (CMV), a member of the herpesviridae family, is a commonly found congenital viral infection in many population groups that occurs in all age groups and at all levels of the community [1, 2].
Cytomegalovirus infection is usually asymptomatic, but sometimes it occurs in some patients with serious and deadly infection. The cytomegalovirus remains in the latent form after a period of active infection. The virus can be reactivated at an appropriate time, such as pregnancy, and the fetus also receives cytomegalovirus infection through the mother. … [3-7].From primary infection and recurrent cytomegalovirus infection, the highest rates of congenital infection is related to mothers who have been infected initially. In cases where the first infection occurs in the last trimester of pregnancy, it is more likely that it will be transmitted to the fetus. However, if the primary infection occurs in the first trimester or early in the second trimester, the chances of transmission is lower, and if transmitted, causes more severe damage to the fetus [3, 5, 8, and 9]. Anti-cytomegalovirus antibodies cannot completely protect the mother and the fetus against infection, infection return, and infection transmission [9-12]. The presence of IgM is also not valid reason for the presence of primary cytomegalovirus infection, since in the case of an infectious disease, there is also an antibody of IgM class, and an antibody titer is beneficial in these cases [2, 5, 13, and 14].cytomegalovirus is now a major contributor to congenital malformation, mental retardation, abortion and infections in neonates and infants. Cytomegalovirus infections have numerous economic, social, and psychological losses [15, 7-17]. In Iran, there is no definite figure for the incidence of congenital cytomegalovirus infection and congenital cytomegalovirus diseases have large side effects and costs. In these cases, the definitive diagnosis of cytomegalovirus infection is based on the isolation of the virus. However, in many cases, especially in screening tests, there is no possibility of the cultivation of the virus (due to its expensiveness and time-consuming nature) [3, 18-22].
The aim of this study was to investigate and compare the molecular method in diagnosis of the disease with other conducted methods and the importance of the molecular method for rapid and correct testing.
This research is descriptive-analytic.
In this study, women who were referred to Javaheri, Bouali, and Amiralmomenin hospitals (affiliated to the Islamic Azad University, Tehran Central Branch) in different weeks of pregnancy and women who had normal delivery were examined in the years 2010-2011.
60 women who had referred for abortion in different weeks of pregnancy and 60 women with normal delivery were examined.
Before the study, consent was taken from all the patients and a questionnaire including age, occupation, history of previous illness, number of pregnancy and previous delivery, abortion time, and number of abortions was designed and the patient`s information revealed from interview was entered into it. Under the class II hood, amniotic fluid was taken from mothers. The samples were first numbered and the same numbers were written in separate tubes, and then 200 μl of each sample was poured into the corresponding tubes. The samples were stored in a freezer. The samples were concentrated and then the DNA was extracted. Amniotic fluid samples were prepared for the extraction of the nucleic acid and the ROCHE kit was used according to the kit method to isolate the DNA. The buffer gene code 280 was amplified using the primers PCR and using primers F GTAGCTGGCATTGCGATTGGT and R TCCAACACCCACAGTACCCGT. PCA was performed in 50 μl tube containing 2 μl KCL, 2 μl Tris (pH 8), 5 μl dNTP, 1.5 μl MgCl2, 1UTaq polymerase, 2727 μl water (molecular DDW grade), 20 Pico mole from each primer and 6-10 μl of isolated DNA. Initial denaturation at 94 ° C for 90 seconds, 40 cycles of denaturation at 94 ° C for 50 seconds, initially annealed at 64 ° C for 50 seconds, a format at 72 ° C for 50 seconds, and a 72 ° C cyclic cycle for 10 minutes were applied, and the product obtained by agarose gel 1.5% along with ethidium bromide was evaluated and identified. Data were analyzed by chi-square test using SPSS 13 software and the results were compared in two groups of abortion (case group) and normal delivery group.
The age range of the case and control group was 25-30 and 30-35 respectively. The mean age of women in the case and control group was 28.50±6.68 and 29.00±5.87 years, respectively. In the women of the case group, the results of PCR was positive for 7(18.9%), 5(27.8%), and 4(80.0%) samples who had no history of abortion (zero abortion), one abortion and two abortions respectively. In the control group, the results of PCR was negative. In the control group, 85.0% of the cases had no history of abortion, and 15.0% had one abortion. In addition, in the control group, 5% of the cases had abortion in less than 20 weeks of pregnancy and 8.3% had preterm delivery or intrauterine death. There was significant relationship between the incidence of CMV and the number of abortions in the mothers of the case group (p<0.05; Table 1).
… [23-26].A study by Ryan et al. in 2005 it was found that cytomegalovirus infection has contaminated about 50-80% of the adult population. This statistic is based on antibody measurements in the population. In addition, it has been shown that cytomegalovirus is the most commonly transmitted mother to fetus virus before the birth. In the low socio-economic conditions in the third world countries, this virus is the most responsible virus in the herpes family for the embryo and neonatal disorders [4, 9, and 14]. In a study by Boeckh et al. in 2004, cytomegalovirus was the most important congenital infections in humans and the second cause of mental retardation (after Down syndrome). The virus is one of the factors among the infections of Torch syndrome that causes congenital anomalies and disorders. In the United States, the prevalence of primary infections of cytomegalovirus in pregnant women was reported to be about 1-3%. Pregnant women do not show any signs. However, in some cases they are seen as having a mononucleosis-like condition and their fetus is at the risk for congenital cytomegalovirus. Now, cytomegalovirus remains the leading cause of congenital viral infection in the United States [10]. In 2003, a study was conducted by Sukhikh, in which serological methods such as IgM and IgG antibody specific kits were used. In this study, PCR was also used to confirm the presence of cytomegalovirus infection in urine specimen, saliva, and amniotic fluid, and the value of the vaccine in preventing infection [8]. In the study of Griffith et al., the prevalence of cytomegalovirus infection with rubella virus in pregnant women was investigated. In 15% of women with primary cytomegalovirus infection, fetal loss was seen and this rate was 7 times higher than control samples. The transmission of the virus in the first trimester, second trimester and the third trimester was 20%, 0% and 40% respectively [21].
It is suggested that more studies be done to evaluate molecular methods and compare the sensitivity and the specificity of it with other methods in the larger population, taking into account geographical condition.
Considering the importance of quick and correct detection of the disease agent before its complications, the molecular method can help to this end even in cases of low pathogenicity.
TABLES and CHARTS
Show attach fileCITIATION LINKS
[1]Summers PR. Microbiology relevant to recurrent miscarriage. Clin Obstet Gynecol. 1994;37(3):722-9.
[2]Rappaport F, Rabinovitz M, Toaff R, Krochik N. Genital listeriosis as a cause of repeated abortion. Lancet. 1960;1(7137):1273-5.
[3]Rad cliffe JJ, Hart CA, Francis WJ, Johnson PM. Immunity to cytomegaloviruses in women with unexplained recurrent spontanous abortion. Am J Reprod Immunol Microbiol. 1986;12(4):103-5.
[4]Sifakis S, Ergazaki M, Sourvinos G, Koffa M, Koumantakis E, Spandidos DA. Evaluation of Parvo B19, CMV and HPV viruses in human aborted materialusing the polymerase chain reaction technique. Eur J Obstet Gynecol Reprod Biol. 1998;76(2):169-73.
[5]Gartner L, Kunkel M, Oberender H. Persistence of IgM antibodies to CMV-induced late antigen in pregnancy andpostpartum. Acta Virol. 1983;27(1):86-8.
[6]Luerti M, Santini A, Bernini O, Castiglioni M, Ragni MC. ELISA antibodies to cytomegalovirus in pregnant patients prevalence in andcorrelation with spontaneous abortion. Biol Res Pregnancy Prinatal. 1983;4(4):181-3.
[7]Szkaradkiewicz A, Pieta P, Tułecka T, Breborowicz G, Słomko Z, Strzyzowski P. The diagnostic value of anti-CMV HPV-B19 antiviral antibodiesin studies on causes of recurrent aboirtions. Ginekol Pol. 1997;68(4):181-6. [Polish]
[8]Sukhikh GT, Dadal'ian LG, Van'ko LV, Kalafati TI, Sidel'nikova VM. Diagnostic and prognostic value of specific immune response to Cytomegaloviruses inpregnant women with a history of habitual abortion. Akush Ginekol (Mosk). 1992;(3-7):30-3. [Russian]
[9]Kost BP, Mylonas I, Kästner R, Rack B, Gingelmaier A, Friese K. Congenital cytomegalovirus infection in pregnancy: A case report of fetal death in a CMV-infected woman. Arch Gynecol Obstet. 2007;276(3): 265-8.
[10]Rajaii, M, Pourhassan A. Evaluation of immunity against CMV in Azarbaijan female population. Iran J Clin Infect Dis. 2008;3(3):143-8.
[11]Ergun UG, Bakaris S, Ucmak H, Ozbek A. Fatal congenital cytomegalovirus infection following recurrent aternal infection after a 7-year interval. Saudi Med J. 2007;28(2):264-7.
[12]Zalel Y, Gilboa Y, Berkenshtat M, Yoeli R, Auslander R, Achiron R, et al. Secondary cytomegalovirus infection can cause severe fetal sequelae despit maternal preconceptional immunity. Ultrasound Obstet Gynecol. 2008;31(4):417-20.
[13]Satilmiş A, Güra A, Ongun H, Mendilcioğlu I, Colak D, Oygür N. CMV seroconversion in pregnants and the incidence of congenital CMV infection. Turk J Pediatr. 2007;49(1):30-6.
[14]Ione R, Fomda BA, Thokar M, Wani T, Kakru D, Shaheen R, et al. Seroprevalence of Cytomegalovirus (CMV) in Kashmir valley-a preliminary study. JK-Practitioner. 2004;11(4):261-2.
[15]Goering R, Dockrell, Zuckerman M, Roitt I, chiodini P. Medical Microbiology. 3rd Edition. Edinburgh: Mosby; 2004.
[16]Gomez E, Loures A, Smelon J, Baltar. Late CMV disease and/or pecursence in renal transplant recipients with pronged oral garciclovirprophylanis. Transplantation smedzin, 2003.
[17]Vanson WJ, The TH. Cytomegalovirus infection after organ transplantation: An update ith special emphasis on renal transplantation. Transpl Int. 1989;2(3):147-64.
[18]The TH, Van Der Bij W, Van Den Berg Ap, Van Der Gissen M, Sprenger Hg, Van son WJ. Cytomegalovirus antigenemia. Rev inf Dis. 1990;12:737-44.
[19]Boeckh M, Bowden RA, Goodrich JM, Pettinger M, Meyerst J. Cytomegalovirus antigen detection in peripheral blood leukocytes after allogeneic narrow transplantation. Blood. 1992;80:1358-64.
[20]Van Der Bij W, Schirm J, Torensma R, Van Son WJ, Tegzess AM, The TH. Comparison between viremia and ntigenemia for detection of cytomegalovirus in blood. J Clin Microbiol. 1988;26(12):2531-5.
[21]Grefte JM, Van Der Gun BT, Sehmolke S, Van Der Giessen M, Van Son WJ, Plachter B, et al. The lower matrix protein pp65 is the principal viral antigen present in peripheral blood leukocytes during an active cytomegalovirus infection. J Gen Virol. 1992;73:2923-32.
[22]Gema G, Revello MG, Percivalle E, Zavattoni M, Parea M, Battaglia M. Quantification of human cytomegalovirus viremia by using monoclonal antibodies to different viral proteins. J Clin Microbiol. 1990;28(12):2681-8.
[23]Nelson CT, Demmler GJ. Cytomegalovirus infection in the pregnant mother, fetus, and newborn infant. Clin Perinatol. 1997;24(1):151-60.
[24]Piper JM, Wen TS. Perinatal cytomegalovirus and toxoplasmosis: Challenges of antepartum therapy. Clin Obstet Gynecol. 1999;42(1):81-96.
[25]Huang JC, Naylor B. Cytomegalovirus infection of the cervix detected by cytology and histology: A report of five cases. Cytopathology. 1993;4(4):237-41.
[26]Friedmann W, Schäfer A, Kretschmer R, Lobeck H. Disseminated cytomegalovirus infection of the female genital tract. Gynecol Obstet Invest. 1991;31(1):56-7.
[2]Rappaport F, Rabinovitz M, Toaff R, Krochik N. Genital listeriosis as a cause of repeated abortion. Lancet. 1960;1(7137):1273-5.
[3]Rad cliffe JJ, Hart CA, Francis WJ, Johnson PM. Immunity to cytomegaloviruses in women with unexplained recurrent spontanous abortion. Am J Reprod Immunol Microbiol. 1986;12(4):103-5.
[4]Sifakis S, Ergazaki M, Sourvinos G, Koffa M, Koumantakis E, Spandidos DA. Evaluation of Parvo B19, CMV and HPV viruses in human aborted materialusing the polymerase chain reaction technique. Eur J Obstet Gynecol Reprod Biol. 1998;76(2):169-73.
[5]Gartner L, Kunkel M, Oberender H. Persistence of IgM antibodies to CMV-induced late antigen in pregnancy andpostpartum. Acta Virol. 1983;27(1):86-8.
[6]Luerti M, Santini A, Bernini O, Castiglioni M, Ragni MC. ELISA antibodies to cytomegalovirus in pregnant patients prevalence in andcorrelation with spontaneous abortion. Biol Res Pregnancy Prinatal. 1983;4(4):181-3.
[7]Szkaradkiewicz A, Pieta P, Tułecka T, Breborowicz G, Słomko Z, Strzyzowski P. The diagnostic value of anti-CMV HPV-B19 antiviral antibodiesin studies on causes of recurrent aboirtions. Ginekol Pol. 1997;68(4):181-6. [Polish]
[8]Sukhikh GT, Dadal'ian LG, Van'ko LV, Kalafati TI, Sidel'nikova VM. Diagnostic and prognostic value of specific immune response to Cytomegaloviruses inpregnant women with a history of habitual abortion. Akush Ginekol (Mosk). 1992;(3-7):30-3. [Russian]
[9]Kost BP, Mylonas I, Kästner R, Rack B, Gingelmaier A, Friese K. Congenital cytomegalovirus infection in pregnancy: A case report of fetal death in a CMV-infected woman. Arch Gynecol Obstet. 2007;276(3): 265-8.
[10]Rajaii, M, Pourhassan A. Evaluation of immunity against CMV in Azarbaijan female population. Iran J Clin Infect Dis. 2008;3(3):143-8.
[11]Ergun UG, Bakaris S, Ucmak H, Ozbek A. Fatal congenital cytomegalovirus infection following recurrent aternal infection after a 7-year interval. Saudi Med J. 2007;28(2):264-7.
[12]Zalel Y, Gilboa Y, Berkenshtat M, Yoeli R, Auslander R, Achiron R, et al. Secondary cytomegalovirus infection can cause severe fetal sequelae despit maternal preconceptional immunity. Ultrasound Obstet Gynecol. 2008;31(4):417-20.
[13]Satilmiş A, Güra A, Ongun H, Mendilcioğlu I, Colak D, Oygür N. CMV seroconversion in pregnants and the incidence of congenital CMV infection. Turk J Pediatr. 2007;49(1):30-6.
[14]Ione R, Fomda BA, Thokar M, Wani T, Kakru D, Shaheen R, et al. Seroprevalence of Cytomegalovirus (CMV) in Kashmir valley-a preliminary study. JK-Practitioner. 2004;11(4):261-2.
[15]Goering R, Dockrell, Zuckerman M, Roitt I, chiodini P. Medical Microbiology. 3rd Edition. Edinburgh: Mosby; 2004.
[16]Gomez E, Loures A, Smelon J, Baltar. Late CMV disease and/or pecursence in renal transplant recipients with pronged oral garciclovirprophylanis. Transplantation smedzin, 2003.
[17]Vanson WJ, The TH. Cytomegalovirus infection after organ transplantation: An update ith special emphasis on renal transplantation. Transpl Int. 1989;2(3):147-64.
[18]The TH, Van Der Bij W, Van Den Berg Ap, Van Der Gissen M, Sprenger Hg, Van son WJ. Cytomegalovirus antigenemia. Rev inf Dis. 1990;12:737-44.
[19]Boeckh M, Bowden RA, Goodrich JM, Pettinger M, Meyerst J. Cytomegalovirus antigen detection in peripheral blood leukocytes after allogeneic narrow transplantation. Blood. 1992;80:1358-64.
[20]Van Der Bij W, Schirm J, Torensma R, Van Son WJ, Tegzess AM, The TH. Comparison between viremia and ntigenemia for detection of cytomegalovirus in blood. J Clin Microbiol. 1988;26(12):2531-5.
[21]Grefte JM, Van Der Gun BT, Sehmolke S, Van Der Giessen M, Van Son WJ, Plachter B, et al. The lower matrix protein pp65 is the principal viral antigen present in peripheral blood leukocytes during an active cytomegalovirus infection. J Gen Virol. 1992;73:2923-32.
[22]Gema G, Revello MG, Percivalle E, Zavattoni M, Parea M, Battaglia M. Quantification of human cytomegalovirus viremia by using monoclonal antibodies to different viral proteins. J Clin Microbiol. 1990;28(12):2681-8.
[23]Nelson CT, Demmler GJ. Cytomegalovirus infection in the pregnant mother, fetus, and newborn infant. Clin Perinatol. 1997;24(1):151-60.
[24]Piper JM, Wen TS. Perinatal cytomegalovirus and toxoplasmosis: Challenges of antepartum therapy. Clin Obstet Gynecol. 1999;42(1):81-96.
[25]Huang JC, Naylor B. Cytomegalovirus infection of the cervix detected by cytology and histology: A report of five cases. Cytopathology. 1993;4(4):237-41.
[26]Friedmann W, Schäfer A, Kretschmer R, Lobeck H. Disseminated cytomegalovirus infection of the female genital tract. Gynecol Obstet Invest. 1991;31(1):56-7.